inverted terminal repeats मीनिंग इन हिंदी

उदाहरण वाक्य

1. Its genome totals 28, 096 bp and presents inverted terminal repeats of 1, 030 bp.
2. Most insertions were found to lie in one of the two inverted terminal repeat ( ITR ) sequences.
3. ARV1 has a genome of 24, 655 bp, including 1365 bp inverted terminal repeats at both ends.
4. Although the sequences of the inverted terminal repeats of the rudiviruses are different, they all carry the motif AATTTAGGAATTTAGGAATTT near the genome ends, which may constitute a signal for the Holliday junction resolvase and DNA replication.
5. During transposition, the PB transposase recognizes transposon-specific inverted terminal repeat sequences ( ITRs ) located on both ends of the transposon vector and efficiently moves the contents from the original sites and efficiently integrates them into TTAA chromosomal sites.
6. One of Chatterjee's most notable publications is from 1999, and she researched the use of a " single stranded AAV, replication-defective nonpathogenic human parvovirus with a 4.7kb DNA genome with a palindromic inverted terminal repeats " This process REQUIRES the use of an adenovirus for the DNA to enter the cell and cause infection, thus being stably integrated into the cells DNA genome in a specific place.
7. At the 5 and 3 ends of this genome are short complementary sequences of approximately 120 to 250 nucleotides, that form secondary structures as hairpins for example inverted terminal repeats ( ITRs which are two identical secondary structures at the termini ) or unique sequences at the termini ( there are two unique and different secondary structures at each end of the DNA ) and are essential for viral genome replication mechanism called rolling-hairpin replication.